Gene putatively regulated by attenuation in S_aureus_MW2

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atactacgtactcaaataatctataacaatttcatatataattctttcggggcagggtgaaattcccaaccggcagtaaataaagcctgcgacctgctaa
tatgtttcatattagtggctgatctagtgagattctagagccgacagttaaagtctggatgggagaaagaatgttaattatcgacaaagataatgtagcg
tatttgtaaaaatgtgtacaaataggcttatttaacgataaatttttctccttgcatcttaattcatgatgtgaggatttttgtttatagaggtgatcat
TTG

    ribD --- ribB --- ribA --- ribH


Gene: ribD     GI: 21283440     BI number: MW1711     GOG: COG0117,COG1985     Description: riboflavin specific deaminase
Gene: ribB     GI: 21283439     BI number: MW1710     GOG: COG0307     Description: riboflavin synthase alpha chain
Gene: ribA     GI: 21283438     BI number: MW1709     GOG: COG0108,COG0807     Description: riboflavin biosynthesis protein
Gene: ribH     GI: 21283437     BI number: MW1708     GOG: COG0054     Description: 6,7-dimethyl-8-ribityllumazine synthas


  a
a  a
t  g
t  t
 gc
 at
 cg
|  g
|  a
a  t
g  g       ca
 cg       a  a       at
 cg       g  a      a  g
g  a       cg       a  t
a  g       ta       a  g
g  a       at        at
a  a       ta        ta
 ta        ta        gc
 cg        at        ta
 ta       |  g       ta
 ta        at        ta
 at        ta        at
g  g       tg        ta
 at        gc       g  g
 gt        tg        cg
 ta        at        gc
                        ttatttaacgataaatttttctccttgcatcttaattcatgatgtgaggatttttgtttatagaggtgatcatTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[H] COG0117 Pyrimidine deaminase ... can be seen here
[H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here
[H] COG0307 Riboflavin synthase alpha chain ... can be seen here
[H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here
[H] COG0807 GTP cyclohydrolase II ... can be seen here
[H] COG0054 Riboflavin synthase beta-chain ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Riboflavin_riboswitch sequence ... can be seen here

    ..................................................................................................................