                                                                        Gene putatively regulated by attenuation in S_aureus_Mu50

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atactacgtactcaaataatctataacaatttcatatataattctttcggggcagggtgaaattcccaaccggcagtaaataaagcctgcgacctgctaa
tatgtttcatattagtggctgatctagtgagattctagagccgacagttaaagtctggatgggagaaagaatgttaattatcgacaaagataatgtagcg
tatttgtaaaaatgtgtacaaataggcttatttaacgataaatttttctccttgcatcttaattcatgatgtgaggatttttgtttatagaggtgatcat
TTG

    ribD --- ribB --- ribA --- SAV1768 --- SAV1767 Gene: ribD     GI: 15924761     BI number: SAV1771     GOG: COG0117,COG1985     Description: riboflavin specific deaminase Gene: ribB     GI: 15924760     BI number: SAV1770     GOG: COG0307     Description: riboflavin synthase alpha chain Gene: ribA     GI: 15924759     BI number: SAV1769     GOG: COG0108,COG0807     Description: riboflavin biosynthesis protein Gene: SAV1768     GI: 15924758     BI number: SAV1768     GOG: -------     Description: 6,7-dimethyl-8-ribityllumazine synthase Gene: SAV1767     GI: 15924757     BI number: SAV1767     GOG: COG0054     Description: lumazine synthas   a a  a t  g t  t gc at cg |  g |  a a  t g  g       ca cg       a  a       at cg       g  a      a  g g  a       cg       a  t a  g       ta       a  g g  a       at        at a  a       ta        ta ta        ta        gc cg        at        ta ta       |  g       ta ta        at        ta at        ta        at g  g       tg        ta at        gc       g  g gt        tg        cg ta        at        gc                         ttatttaacgataaatttttctccttgcatcttaattcatgatgtgaggatttttgtttatagaggtgatcatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................