                                                                        Gene putatively regulated by attenuation in S_aureus_aureus_MRSA252

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atactacgtactcaaataatctataacaatttcatataTAATTCTTTCGGGGCAGGGTGAAATTCCCAACCGGC
AGTAAATTAAGCCTGCGACCTGCTAATATGTTTCGTATTAGTGGCTGATCTAGTGAGA
CTCTAGAGCCGACAGTTAAAGTCTGGATGGGAGAAAGAATGTtaattatcgacaaagataatgtagcgt
atttgtaaaaatgtgtacaaataggcttatttaacgataaatttttctccttgcatcttaattcatgatgtgaggatttttgtttatagaggtgatcatT
TG

    ribD --- ribE --- ribA --- ribH Gene: ribD     GI: 49484015     BI number: SAR1853     GOG: COG1985,COG0117     Description: bifunctional riboflavin biosynthesis protein Gene: ribE     GI: 49484014     BI number: SAR1852     GOG: COG0307     Description: riboflavin synthase alpha chain Gene: ribA     GI: 49484013     BI number: SAR1851     GOG: COG0108,COG0807     Description: riboflavin biosynthesis protein Gene: ribH     GI: 49484012     BI number: SAR1850     GOG: COG0054     Description: 6,7-dimethyl-8-ribityllumazine synthas ca a  a       at g  a      a  g cg       a  t ta       a  g at        at ta        ta ta        gc at        ta |  g       ta at        ta ta        at Tg        ta Gc       g  g Tg        cg At        gc             ttatttaacgataaatttttctccttgcatcttaattcatgatgtgaggatttttgtttatagaggtgatcatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................