                                                                        Gene putatively regulated by attenuation in S_aureus_aureus_MSSA476

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:204 nt.    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.40 kcal/mol
Antiterminator:    Distance from promoter:178 nt. Size=37 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:    Distance from promoter:142 nt.    Size=56 nt.     Delta G= -6.46 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTAT-TATAAT. It has a score value of 78.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTATTGCTCGCGGAATTTAAGATATAATGAAATCGCATTCAAGAAATTTGATAGTC
ATTTGCTATCAATTTCAGAAATATATTATGAATTGCTAAATTTAATAAAAGCGAGTGA
TCAGTATTAGagagaatagagcgttaagactctatcgccgaaggtgcaagtaatttattacgaaactctcaggcaaaaggataatactgtaac
gcgttcctgaattggtgatttataaacagggtagcgattgctatcctgtttttataattttaagggggtatttcaATG

    SAS1475 --- SAS1474 --- SAS1473 Gene: SAS1475     GI: 49486373     BI number: SAS1475     GOG: COG0404     Description: putative aminomethyltransferase Gene: SAS1474     GI: 49486372     BI number: SAS1474     GOG: COG0403     Description: putative glycine cleavage system P-protein Gene: SAS1473     GI: 49486371     BI number: SAS1473     GOG: COG1003,COG0403     Description: putative glycine cleavage system P-protei ta a  c at tg at |  a g  a g  c a  g a  c a  g a  t       ga c  t      t  t gc        gt gc        gt at        ta cg       |  t ta       t  a c  a      a  a       at t  |      a  a      g  t c  |       gc        cg a  |       ta        gc at        cg        at at        cg        ta g  g       tg        gt cg       t  t       gc at       g  a       gc tg        cg        at ta        gc        cg at        cg        at                         ttttataattttaagggggtatttcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0404 Glycine cleavage system T protein (aminomethyltransferase) ... can be seen here [E] COG0403 Glycine cleavage system protein P (pyridoxal-binding), N-terminal domain ... can be seen here [E] COG1003 Glycine cleavage system protein P (pyridoxal-binding), C-terminal domain ... can be seen here [E] COG0403 Glycine cleavage system protein P (pyridoxal-binding), N-terminal domain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................