                                                                        Gene putatively regulated by attenuation in S_aureus_aureus_MSSA476

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atactacgtactcaaataatctataacaatttcatataTAATTCTTTCGGGGCAGGGTGAAATTCCCAACCGGC
AGTAAATAAAGCCTGCGACCTGCTAATATGTTTCATATTAGTGGCTGATCTAGTGAGA
TTCTAGAGCCGACAGTTAAAGTCTGGATGGGAGAAAGAATGTtaattatcgacaaagataatgtagcgt
atttgtaaaaatgtgtacaaataggcttatttaacgataaatttttctccttgcatcttaattcatgatgtgaggatttttgtttatagaggtgatcatT
TG

    SAS1694 --- SAS1693 --- SAS1692 --- SAS1691 Gene: SAS1694     GI: 49486593     BI number: SAS1694     GOG: COG1985,COG0117     Description: bifunctional riboflavin biosynthesis protein Gene: SAS1693     GI: 49486592     BI number: SAS1693     GOG: COG0307     Description: riboflavin synthase alpha chain Gene: SAS1692     GI: 49486591     BI number: SAS1692     GOG: COG0108,COG0807     Description: riboflavin biosynthesis protein Gene: SAS1691     GI: 49486590     BI number: SAS1691     GOG: COG0054     Description: 6,7-dimethyl-8-ribityllumazine synthas   A A  A T  G T  T GC AT CG |  G |  A A  T G  G       ca CG       a  a       at CG       g  a      a  g G  A       cg       a  t A  G       ta       a  g G  A       at        at A  A       ta        ta TA        ta        gc CG        at        ta TA       |  g       ta TA        at        ta AT        ta        at G  G       Tg        ta AT        Gc       g  g Gt        Tg        cg Ta        At        gc                         ttatttaacgataaatttttctccttgcatcttaattcatgatgtgaggatttttgtttatagaggtgatcatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................