                                                                        Gene putatively regulated by attenuation in S_epidermidis_ATCC_12228

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:154 nt.    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.60 kcal/mol
Antiterminator:    Distance from promoter:121 nt. Size=42 nt.     Delta G= -8.70 kcal/mol
Anti-antiterminator:    Distance from promoter:89 nt.    Size=55 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgagt-taatat. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgagtttttaaaactaataatgtaatataaatttaaaataaaattgatatattcatcttcggggtagggtgtaattcccaaccggcagtaatctaagcc
tgcgacgacaacgtattaatttttgctttgtcttgattcagtgagagtctgaagccgacagtatagtctggatgggagaagatggaggttttttgttgtt
caaatttcctccttttctaagtaagatgaatggaaggagaaaattatatATG

    SE1174 Gene: SE1174     GI: 27468092     BI number: SE1174     GOG: COG3601     Description: conserved hypothetical protei   g a  a g  g t  t gc at cg ta ta a  g       ga g  c      g  t t  c       tg t  |       cg cg        tg ta       g  a gc       a  g        g ta       t  a      t  t tg       a  a      t  t |  t      t  g       gc |  a      g  a       ta |  t       at        ta ta        cg        ta cg       a  g      t  t gt       g  a      t  t t  c       cg       t  t t  t       cg        gc tg        gt        gc tg        at        at ta        at        gc at        gt        gc                         ttttctaagtaagatgaatggaaggagaaaattatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3601 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................