Gene putatively regulated by attenuation in S_epidermidis_ATCC_12228

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:197 nt.    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.30 kcal/mol
Antiterminator:    Distance from promoter:170 nt. Size=41 nt.     Delta G= -5.26 kcal/mol
Anti-antiterminator:    Distance from promoter:149 nt.    Size=35 nt.     Delta G= -3.66 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-GAAATT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATAGTGCACAGAGTGTTTCTGAAATTTGCACTTTAATTAAAACAAAATTATTAAG
CGATTGATCAGTATTAGAGAGAATAGAGATCAAAACTTGAATCATtataagttaaacgtttttagtc
tattacaattttgactctctatcgccgaaggtgcaagtgaaataacgaaactctcaggcaaaaggataatactgtaacgcattcctgaaatgtgtattaa
aacagggtagctttatgctatcctgttttttaaaaattattaattgggggtacacgtATG

    SE1222 --- SE1221 --- SE1220


Gene: SE1222     GI: 27468140     BI number: SE1222     GOG: COG0404     Description: aminomethyltransferase
Gene: SE1221     GI: 27468139     BI number: SE1221     GOG: COG0403     Description: glycine dehydrogenase (decarboxylating) subunit 1
Gene: SE1220     GI: 27468138     BI number: SE1220     GOG: COG1003     Description: glycine dehydrogenase (decarboxylating) subunit


            t
          g  a
          t  t
 ta       g  t
a  c      t  a
 at       a  a
 tg       a  a
 at       a  a
|  a       gc         t
g  a       ta       t  a
g  c       cg       t  t
a  g       cg        cg
a  c       tg        gc
a  a      t  t       at
a  t      a  a       ta
c  t       cg        gt
 gc        gc        gc
 gc       c  t       gc
 at        at        at
 cg        at        cg
 ta        ta        at
                        tttttaaaaattattaattgggggtacacgtATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0404 Glycine cleavage system T protein (aminomethyltransferase) ... can be seen here
[E] COG0403 Glycine cleavage system protein P (pyridoxal-binding), N-terminal domain ... can be seen here
[E] COG1003 Glycine cleavage system protein P (pyridoxal-binding), C-terminal domain ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Glycine_cleavage sequence ... can be seen here

    ..................................................................................................................