Gene putatively regulated by attenuation in S_epidermidis_ATCC_12228

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:51 nt.    Distance to gene:12 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-13.40 kcal/mol
Antiterminator:    Distance from promoter:24 nt. Size=38 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-10.14 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: gtgtag-tatact. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtgtagttatgataagcgtattgtatacttatgtgcaatttttagtatgctaataggcttatttaaagatatagatatctccttatgcctacaatatagg
tataaggttttttttgaggtgatcaaTTG

    SE1441 --- SE1440 --- SE1439 --- SE1438


Gene: SE1441     GI: 27468359     BI number: SE1441     GOG: COG0117,COG1985     Description: riboflavin specific deaminase
Gene: SE1440     GI: 27468358     BI number: SE1440     GOG: COG0307     Description: riboflavin synthase alpha chain
Gene: SE1439     GI: 27468357     BI number: SE1439     GOG: COG0108,COG0807     Description: riboflavin biosynthesis protein
Gene: SE1438     GI: 27468356     BI number: SE1438     GOG: COG0054     Description: 6,7-dimethyl-8-ribityllumazine synthas


 ca
g  a
t  t       ag
g  t      t  a
t  t       at
a  t       ta
t  t       at
 ta        gc
 cg        at         a
 at       a  c      a  t
 ta       a  c      c  a
 at       t  t       at
 tg       t  |       ta
 gc       t  |       cg
|  t       at        cg
 ta        ta        gt
 ta       t  t       ta
 at        cg        at
 ta        gc        ta
g  g       gc        ta
 cg        at        cg
 gc        ta        cg
                        ttttttttgaggtgatcaaTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[H] COG0117 Pyrimidine deaminase ... can be seen here
[H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here
[H] COG0307 Riboflavin synthase alpha chain ... can be seen here
[H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here
[H] COG0807 GTP cyclohydrolase II ... can be seen here
[H] COG0054 Riboflavin synthase beta-chain ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Riboflavin_riboswitch sequence ... can be seen here

    ..................................................................................................................