                                                                        Gene putatively regulated by attenuation in S_agalactiae_2603

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:107 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-23.00 kcal/mol
Antiterminator: Size=69 nt.     Delta G=-14.11 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-11.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcggggtcaggtgaaaatcctaaccggcggtatagtccgcgagctttcgagcatgaactggtgtgattccagtaccgacagtaaagtctggatgagagaa
gaattcagtgattgtctgctacttgcagtttatttgtgctggattaatgagagactccctatagttttctatagggagtctttagtttttttgtgctacc
taaaatataatgctaattagtataatcaacgacttctcatccctccccttagttttctattttagaagctaagggtttttattttagaaggaaaaaggaa
ATG

    ribD --- ribE --- ribA --- ribH Gene: ribD     GI: 22536910     BI number: SAG0746     GOG: COG0117,COG1985     Description: riboflavin biosynthesis protein RibD Gene: ribE     GI: 22536911     BI number: SAG0747     GOG: COG0307     Description: riboflavin synthase, alpha subunit Gene: ribA     GI: 22536912     BI number: SAG0748     GOG: COG0108,COG0807     Description: riboflavin biosynthesis protein RibA Gene: ribH     GI: 22536913     BI number: SAG0749     GOG: COG0054     Description: riboflavin synthase, beta subuni             c           a  t           t  t            cg            gc            ta            cg           t  t   g       g  t a  a      t  t g  a       ta a  g       at g  a       gt ta       |  t at       |  g gt       |  t gc        tg ta        gc cg        at t  t       cg g  g       tg        tt a  |       ta       t  t a  |       at        gc a  |       at        at ta       |  a       ta gt       g  a       at at       a  t       ta cg       a  g       cg at       g  a       cg gc       a  g       cg |  t      g  a       ta c  g      a  g       cg c  c      g  a       at at       t  c       gc ta        at        at gc        gc        gt at        gc        at                         agtttttttgtgctacctaaaatataatgctaattagtataatcaacgacttctcatccctccccttagttttctattttagaagctaagggtttttattttagaaggaaaaaggaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................