                                                                        Gene putatively regulated by attenuation in S_agalactiae_2603

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:181 nt.    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:129 nt. Size=65 nt.     Delta G=-22.30 kcal/mol
Anti-antiterminator:    Distance from promoter:132 nt.    Size=28 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcaa-tatgct. It has a score value of 75.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcaattgcaagttttttttgttatgctataggtgtcttcagggcagggtgtaattcccgaccggcggtaatcgcttccaacttatttgtcagttgtga
agcatcagtccgcgagcgaaagctgatgtggtgagattccacaaccgacagtaaagtctggatgggagaagacaaaggttttttcgcgtacatacgctta
cctttggagcttctttcaatttatttaaattggaggaatttttttATG

    SAG1402 --- SAG1401 Gene: SAG1403     GI: 22537550     BI number: SAG1403     GOG: COG3601     Description: membrane protein, putative Gene: SAG1402     GI: 22537549     BI number: SAG1402     GOG: COG0671     Description: PAP2 family protei            ca           a  t            ta            gc            cg            gc           c  t           t  t           t  |           t  |           t  |           t  |            ta            gc            gc            at            at            at            cg           |  g           |  a           a  g aa        gc        tt a  g       at       a  t cg        at        ta at        gc        ta gt        at        ta at       g  t       at at       g  t       at gt        gc        cg at        ta        tg gc       |  a       ta g  g       at        tg gc        gt        cg tg        gt        ta at        ta        ta                         tttttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3601 Predicted membrane protein ... can be seen here [I] COG0671 Membrane-associated phospholipid phosphatase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................