                                                                        Gene putatively regulated by attenuation in S_agalactiae_NEM316

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:182 nt.    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:133 nt. Size=57 nt.     Delta G=-21.60 kcal/mol
Anti-antiterminator:    Distance from promoter:130 nt.    Size=34 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcaa-tatgct. It has a score value of 75.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcaattgcaagttttttttgttatgctataggtgtcttcagggcagggtgtaattcccgaccggcggtaatcgcttccaacttatttgtcagttgtga
agcatcagtccgcgagcgaaagctgatgtggtgagattccacaaccgacagtaaagtctggatgggagaagacaaaggtttttttcgcgtacctacgctt
acctttggagcttctttcaatttatttaaattggaggaatttttttATG

    gbs1473 --- gbs1472 Gene: gbs1473     GI: 25011515     BI number: gbs1473     GOG: COG3601     Description: Unknown Gene: gbs1472     GI: 25011514     BI number: gbs1472     GOG: COG0671     Description: Unknow            cc           a  t            ta            gc            cg            gc           c  t           t  t           t  |           t  |           t  |           t  |           t  |            ta aa        gc a  g       gc cg        at at        at gt        at        tt at        cg       a  t at       |  g       ta gt       |  a       ta at       a  g       ta gt        gc        at gc        at        at |  g       at        cg gc        gc        tg tg        at        ta at       g  t       tg |  a      g  t       cg gc        gc        ta gc        ta        ta                         tttttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3601 Predicted membrane protein ... can be seen here [I] COG0671 Membrane-associated phospholipid phosphatase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................