                                                                        Gene putatively regulated by attenuation in S_mutans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:41 nt.    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-21.40 kcal/mol
Antiterminator:    Distance from promoter:14 nt. Size=34 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCACC-AATGAt. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCACCTTTACAAGATATTGCCAAATGAttgtgagtgtagcaaaagctttacggcgtttaggaaaatttcagagcttag
ggaaacgtttgtttcgtttttctaagctctttttgtaagcaatgttaaagaattttctaaaatttcctgccagttatggtaaaatagagaaaataaacaa
tggagagaaaaATG

    SMU.782 --- aroA --- aroK Gene: aroA     GI: 24379242     BI number: SMU.784     GOG: COG0128     Description: 5-enolpyruvylshikimate-3-phosphate synthase Gene: aroK     GI: 24379243     BI number: SMU.785     GOG: COG0703     Description: putative shikimate kinase Gene: pheA     GI: 24379244     BI number: SMU.786     GOG: COG0077     Description: putative prephenate dehydratas aa a  a cg gc at                   g t  |                t  t g  |       gg       t  t t  |      a  a      t  t g  |       ta        gc at        ta        cg gt        ta        at ta        gt        at gc       c  t       at tg        gt       g  t tg        gc       g  t A  |      c  |       gc Gc       a  |       at Tg        ta        ta At        tg        ta At        ta        cg At        cg        gc |  a       gc        at Cg        at        gc Cg        at        at                         ttttgtaagcaatgttaaagaattttctaaaatttcctgccagttatggtaaaatagagaaaataaacaatggagagaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here [E] COG0703 Shikimate kinase ... can be seen here [E] COG0077 Prephenate dehydratase ... can be seen here     ..................................................................................................................