                                                                        Gene putatively regulated by attenuation in S_mutans

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:178 nt.    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.60 kcal/mol
Antiterminator:    Distance from promoter:167 nt. Size=16 nt.     Delta G= -3.40 kcal/mol
Anti-antiterminator:    Distance from promoter:130 nt.    Size=42 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tacaat. It has a score value of 80.99 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacagttttattgaaattctatacaataaaagaataaaaatagtaaaaccgagtgacattattaggataactgataattgacggacttctggagagac
ctactaggcgccgaaggggcaaggctgtttgctcaaactctcaggcaaaaggacagaaaagaaaaaaagaatttttaatgttgaaacaattcttatcttc
taactctagaggtatcgtcaagtattgacaacctcttttttgatttccatttcggtttatgaggagaaaagtttatATG

    SMU.1175 Gene: SMU.1175     GI: 24379605     BI number: SMU.1175     GOG: COG1115     Description: putative sodium/amino acid (alanine) symporte tg a  t at tg ta ta |  a                  t |  c                g  a ta                  at ta                  at at                  cg at                  ta gc                  gc at                 c  a at        ct       t  | a  a      a  c      a  | a  t       at        ta a  c       ta        gc at        cg        gc at        ta        at gc        tg        gc at        cg        at                         tttttgatttccatttcggtttatgaggagaaaagtttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1115 Na+/alanine symporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................