                                                                        Gene putatively regulated by attenuation in S_pneumoniae_R6

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:211 nt.    Distance to gene:13 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-18.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tataat. It has a score value of 97.72 and is shown in blue

ttgacatattcaaaattaagtactataatcatctgtaattgaataactatcttcagggcagggtgcaattccctaccggtggtatagcccacgagccgaa
aggcatgatttggtgaaattccaaagccgacagtatagtctggatgaaagaagataaaagtatatttgtgctttttgcgtgctctgaaatgattacttgt
catttcagagcatttttgttaatcgcataagttttcttttgtatgccttgagtagtcccctattcaaggtatattttttggaggtagtgagATG

    ribD --- ribC --- ribA --- ribE Gene: ribD     GI: 15902208     BI number: spr0164     GOG: COG0117,COG1985     Description: Riboflavin biosynthese; a deaminase Gene: ribC     GI: 15902207     BI number: spr0163     GOG: COG0307     Description: Riboflavin synthase alpha-chain Gene: ribA     GI: 15902206     BI number: spr0162     GOG: COG0108,COG0807     Description: Riboflavin biosynthesis; GTP-cyclohydrolase II. Gene: ribE     GI: 15902205     BI number: spr0161     GOG: COG0054     Description: Riboflavin synthase beta chai           cc          t  c           gc           at           ta           gt           at           gc           ta           ta           cg           cg           gt           ta           at           ta           gt             tttttggaggtagtgagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in S_pneumoniae_R6 This operon is putativelly rgulated by Riboflavin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:149 nt.    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-21.50 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgaca-tataat. It has a score value of 97.72 and is shown in blue ttgacatattcaaaattaagtactataatcatctgtaattgaataactatcttcagggcagggtgcaattccctaccggtggtatagcccacgagccgaa aggcatgatttggtgaaattccaaagccgacagtatagtctggatgaaagaagataaaagtatatttgtgctttttgcgtgctctgaaatgattacttgt catttcagagcatttttgttaatcgcataagttttcttttgtatgccttgagtagtcccctattcaaggtatattttttggaggtagtgagATG     ribD --- ribC --- ribA --- ribE Gene: ribD     GI: 15902208     BI number: spr0164     GOG: COG0117,COG1985     Description: Riboflavin biosynthese; a deaminase Gene: ribC     GI: 15902207     BI number: spr0163     GOG: COG0307     Description: Riboflavin synthase alpha-chain Gene: ribA     GI: 15902206     BI number: spr0162     GOG: COG0108,COG0807     Description: Riboflavin biosynthesis; GTP-cyclohydrolase II. Gene: ribE     GI: 15902205     BI number: spr0161     GOG: COG0054     Description: Riboflavin synthase beta chai            c          a  t          t  t           tg           at           gc           ta           at           at           at           gc           ta           cg           ta           cg           gc           ta           gt             ttttgttaatcgcataagttttcttttgtatgccttgagtagtcccctattcaaggtatattttttggaggtagtgagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................