Gene putatively regulated by attenuation in S_pneumoniae_R6

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:59 nt.    Distance to gene:120 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.90 kcal/mol
Antiterminator:    Distance from promoter:14 nt. Size=56 nt.     Delta G= -6.75 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -4.67 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgctg-tataat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgctgatacaacctctctacctataatctcacagttaacctgaggctagtttcatagtttgctatttgattttcgttgataaaaagaaatgctcctcca
agacggaagagcattttttattgtgattcttacacatttacttcctagttttgcaggaagtctagtataccattttttaaaagaagagtaaaaaagcaag
ggtagtttcttttttgagaattgtctaaaagtttgatataATG

    aroE --- aroB --- aroC --- tyrA --- spr1230 --- aroA --- aroK


Gene: spr1236     GI: 15903279     BI number: spr1236     GOG: COG1092     Description: Conserved hypothetical protein
Gene: aroD     GI: 15903278     BI number: spr1235     GOG: COG0710     Description: 3-dehydroquinate dehydratase
Gene: aroE     GI: 15903277     BI number: spr1234     GOG: COG0169     Description: Shikimate dehydrogenase
Gene: aroB     GI: 15903276     BI number: spr1233     GOG: COG0337     Description: 3-dehydroquinate synthase
Gene: aroC     GI: 15903275     BI number: spr1232     GOG: COG0082     Description: Chorismate synthase
Gene: tyrA     GI: 15903274     BI number: spr1231     GOG: COG0287     Description: Prephenate dehydrogenase
Gene: spr1230     GI: 15903273     BI number: spr1230     GOG: COG3679     Description: Conserved hypothetical protei


           tt
          t  g
           gc
           at
           ta
           at
          |  t
          |  t
          |  g
          |  a
          |  t
          |  t
 ct       |  t
t  c      |  t
a  a      |  c
a  c      |  g
t  a      |  t
a  g      |  t
t  t      |  g
c  t      |  a
c  a      |  t
a  a      |  a
t  c      |  a
c  c      |  a        g
t  t      |  a      a  a
 cg       |  a      a  c
 ta        cg        cg
 cg        ta        cg
 cg        ta        ta
|  c       ta       c  a
a  t       gt        cg
a  a      a  g       ta
 cg       t  c       cg
 at       c  t       gc
t  t       gc        ta
 at        gc        at
 gc        at        at
 ta        gc        at
                        tttattgtgattcttacacatttacttcctagttttgcaggaagtctagtataccattttttaaaagaagagtaaaaaagcaagggtagtttcttttttgagaattgtctaaaagtttgatataATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG1092 Predicted SAM-dependent methyltransferases ... can be seen here
[E] COG0710 3-dehydroquinate dehydratase ... can be seen here
[E] COG0169 Shikimate 5-dehydrogenase ... can be seen here
[E] COG0337 3-dehydroquinate synthetase ... can be seen here
[E] COG0082 Chorismate synthase ... can be seen here
[E] COG0287 Prephenate dehydrogenase ... can be seen here
[S] COG3679 Uncharacterized conserved protein ... can be seen here

    ..................................................................................................................