                                                                        Gene putatively regulated by attenuation in S_pneumoniae_TIGR4

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:99 nt.    Distance to gene:13 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-18.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: gtgaaa-tagtct. It has a score value of 61.58 and is shown in blue

gtgaaattccaaagccgacagtatagtctggatgaaagaagataaaagtatatttgtgctttttgcgtgctctgaaatgattacttgtcatttcagagca
tttttgttaatcgcataagttttcttttgtatgccttgagtagtcccctattcaaggtatatttttttggaggtagcgagATG

    SP0178 --- SP0177 --- SP0176 --- SP0175 Gene: SP0178     GI: 15900115     BI number: SP0178     GOG: COG0117,COG1985     Description: riboflavin biosynthesis protein RibD Gene: SP0177     GI: 15900114     BI number: SP0177     GOG: COG0307     Description: riboflavin synthase, alpha subunit Gene: SP0176     GI: 15900113     BI number: SP0176     GOG: COG0108,COG0807     Description: 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II Gene: SP0175     GI: 15900112     BI number: SP0175     GOG: COG0054     Description: riboflavin synthase, beta subuni           cc          t  c           gc           at           ta           gt           at           gc           ta           ta           cg           cg           gt           ta           at           ta           gt             ttttttggaggtagcgagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in S_pneumoniae_TIGR4 This operon is putativelly rgulated by Riboflavin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-21.50 kcal/mol                                                                         Nomenclature/Definitions tttatctgttgacatattcaaaattaagtactataatcatctgtaattgaataactatcttcagggcagggtgaaattccctaccggtggtatagcccac gagccgaaaggcatgatttggtgaaattccaaagccgacagtatagtctggatgaaagaagataaaagtatatttgtgctttttgcgtgctctgaaatga ttacttgtcatttcagagcatttttgttaatcgcataagttttcttttgtatgccttgagtagtcccctattcaaggtatatttttttggaggtagcgag ATG     SP0178 --- SP0177 --- SP0176 --- SP0175 Gene: SP0178     GI: 15900115     BI number: SP0178     GOG: COG0117,COG1985     Description: riboflavin biosynthesis protein RibD Gene: SP0177     GI: 15900114     BI number: SP0177     GOG: COG0307     Description: riboflavin synthase, alpha subunit Gene: SP0176     GI: 15900113     BI number: SP0176     GOG: COG0108,COG0807     Description: 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II Gene: SP0175     GI: 15900112     BI number: SP0175     GOG: COG0054     Description: riboflavin synthase, beta subuni            c          a  t          t  t           tg           at           gc           ta           at           at           at           gc           ta           cg           ta           cg           gc           ta           gt             ttttgttaatcgcataagttttcttttgtatgccttgagtagtcccctattcaaggtatatttttttggaggtagcgagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................