                                                                        Gene putatively regulated by attenuation in S_pneumoniae_TIGR4

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:196 nt.    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-14.50 kcal/mol
Antiterminator:    Distance from promoter:135 nt. Size=66 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-taaaat. It has a score value of 91.03 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaaaagccaacattttttgtaaaattagaatcaattaaataccaacaccgaatgaagtTTAATAGAAGTGGGGAATCGTT
TGATTTTCCATGACTGTAAATGGACGGAACTCTGGAGAGACCGTAAAGGCACCGAAGG
GGCAAGGCAGGCAACTGCTCAAactctcaggtaaaaggacagagctaggatagaccgctttttagcatttatctaagcattcca
gagtacatgtatcttgcatgtgctctttcttttggggttgaaacgataggagaaggaaATG

    SP0408 Gene: SP0408     GI: 15900327     BI number: SP0408     GOG: COG1115     Description: sodium:alanine symporter family protei tt t  t ta cg gc c  a c  | at gt at ta at gc gt a  a ta cg gc a  a g  t a  | c  | at gc gc a  |        c a  |      t  t a  |      a  t a  |       tg t  |       gc g  |       ta g  |       at a  |       cg c  |       at ta        tg cg        gc ta        at cg        gc at        at             ttcttttggggttgaaacgataggagaaggaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1115 Na+/alanine symporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................