Gene putatively regulated by attenuation in S_pneumoniae_TIGR4

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:61 nt.    Distance to gene:122 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.10 kcal/mol
Antiterminator:    Distance from promoter:14 nt. Size=56 nt.     Delta G= -6.75 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -4.67 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgctg-tataat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgctgatacaacctctctacctataatctcacagttaacctgaggctagttTCATAGTTTGCTATTTGATTTTCGTTGA
TAAAAAGAAATGCTCCTCCAAGACGGAAGAGCATTTTTTACTGTGATTCTTACACATT
TACTTCCTAGTTTTGCAGGAAGTCTAGTATACCATTTTTTAAAAGAAGAGTAAAAAAG
CAAgggtagtttcttttttgagaattgtctaaaagtttgatataATG

    SP1378 --- SP1377 --- SP1376 --- SP1375 --- SP1374 --- SP1373 --- SP1372


Gene: SP1378     GI: 15901232     BI number: SP1378     GOG: COG1092     Description: conserved hypothetical protein
Gene: SP1377     GI: 15901231     BI number: SP1377     GOG: COG0710     Description: 3-dehydroquinate dehydratase
Gene: SP1376     GI: 15901230     BI number: SP1376     GOG: COG0169     Description: shikimate 5-dehydrogenase
Gene: SP1375     GI: 15901229     BI number: SP1375     GOG: COG0337     Description: 3-dehydroquinate synthase
Gene: SP1374     GI: 15901228     BI number: SP1374     GOG: COG0082     Description: chorismate synthase
Gene: SP1373     GI: 15901227     BI number: SP1373     GOG: COG0287     Description: prephenate dehydrogenase
Gene: SP1372     GI: 15901226     BI number: SP1372     GOG: COG3679     Description: conserved hypothetical protei


           TT
          T  G
           GC
           AT
           TA
           AT
          |  T
          |  T
          |  G
          |  A
          |  T
          |  T
 ct       |  T
t  c      |  T
a  a      |  C
a  c      |  G
t  a      |  T
a  g      |  T
t  t      |  G
c  t      |  A
c  a      |  T
a  a      |  A
t  c      |  A
c  c      |  A
t  t      |  A
 cg       |  A        G
 ta        CG       A  A
 cg        TA       A  C
 cg        tA        CG
|  c       tA        CG
a  t       gT        TA
a  a      a  G      C  A
 cg       t  C       CG
 at       c  T       TA
t  t       gC        CG
 aT        gC        GC
 gC        aT        TA
 tA        gC        AT
                        TTTTTACTGTGATTCTTACACATTTACTTCCTAGTTTTGCAGGAAGTCTAGTATACCATTTTTTAAAAGAAGAGTAAAAAAGCAAgggtagtttcttttttgagaattgtctaaaagtttgatataATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG1092 Predicted SAM-dependent methyltransferases ... can be seen here
[E] COG0710 3-dehydroquinate dehydratase ... can be seen here
[E] COG0169 Shikimate 5-dehydrogenase ... can be seen here
[E] COG0337 3-dehydroquinate synthetase ... can be seen here
[E] COG0082 Chorismate synthase ... can be seen here
[E] COG0287 Prephenate dehydrogenase ... can be seen here
[S] COG3679 Uncharacterized conserved protein ... can be seen here

    ..................................................................................................................