                                                                        Gene putatively regulated by attenuation in T_tengcongensis

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-13.90 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-11.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

acgggtgagaatcccgcgcagcccccgctactgtgagggaggacgaagccctagtaagccactgtccggcactcaactgagcgcgttagtaaggagaaaa
gagggagagaaattgcgttcagttgagtgccgggtgggaaggcagggtggaggatgagtcccgagccaggagacctgccataaggttttagaagttcgcc
ttcggagggaaggttgaacctttttgaagttttgtgcaaaaaggtcttcctctgaagggaaggccttttttatataaaatttttgaaaggagttttttct
ATG

    BtuR Gene: BtuR     GI: 20806883     BI number: TTE0370     GOG: COG2109     Description: ATP:corrinoid adenosyltransferas            tt           t  t           g  g   a       a  t g  g      a  g g  g       gc cg        ta ta        ta ta        ta cg        ta cg        ta |  t       cg         g gt        cg       t  a cg        at       c  a ta       a  |       tg ta       g  |       cg gc       t  |       cg |  c      t  |       ta |  t      g  |       ta at        gc        cg at        at        tg gt        at        gc at        gc        gc tg        gc        at ta        gt        at                         ttttatataaaatttttgaaaggagttttttctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2109 ATP:corrinoid adenosyltransferase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in T_tengcongensis This operon is putativelly rgulated by Cobalamin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-10.30 kcal/mol Antiterminator: Size=48 nt.     Delta G=-13.60 kcal/mol Anti-antiterminator:   Size=39 nt.     Delta G=-14.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case acgggtgagaatcccgcgcagcccccgctactgtgagggaggacgaagccctagtaagccactgtccggcactcaactgagcgcgttagtaaggagaaaa gagggagagaaattgcgttcagttgagtgccgggtgggaaggcagggtggaggatgagtcccgagccaggagacctgccataaggttttagaagttcgcc ttcggagggaaggttgaacctttttgaagttttgtgcaaaaaggtcttcctctgaagggaaggccttttttatataaaatttttgaaaggagttttttct ATG     BtuR Gene: BtuR     GI: 20806883     BI number: TTE0370     GOG: COG2109     Description: ATP:corrinoid adenosyltransferas            ca           c  t           g  a            ta ga        cg t  g       cg at        at gc        gt gc        at |  c       gt |  g      |  a |  a      g  g a  g      a  a gc       c  a        a gc        cg       g  g ta        gt       g  g |  g       at        cg |  g       gc        ta |  a       cg        ta |  g      |  c       cg g  a      |  c       cg gc       |  t      |  t gc       |  t       gt at       |  c       cg cg        cg        ta gc        cg        ta gc        ta        gc                         ctttttgaagttttgtgcaaaaaggtcttcctctgaagggaaggccttttttatataaaatttttgaaaggagttttttctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2109 ATP:corrinoid adenosyltransferase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................