                                                                        Gene putatively regulated by attenuation in T_tengcongensis

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -7.03 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-15.21 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcccgtgatgggttaaaagggaagacgggtgagaatcccgcgcagcccccgctactgtgagggaggacgaagccctagtaagccactgtccggcactcaa
ctgagcgcgttagtaaggagaaaagagggagagaaattgcgttcagttgagtgccggatgggaaggcagggtggaggatgagtcccgagccaggagacct
gccataaggtttttaaaagttcgccttcggagggaaggttgaacggcctttgtgtgtttttaagtgaaaaaggtctacctccgcaaggggtaggcctttt
TTG

    FecB --- BtuC --- FepC --- CobB --- CobQ --- CbiB --- TTE0378 --- TTE0379 --- HisC --- CobU --- CobS Gene: FecB     GI: 20806884     BI number: TTE0372     GOG: COG0614     Description: ABC-type Fe3+-siderophores transport systems, periplasmic components Gene: BtuC     GI: 20806885     BI number: TTE0373     GOG: COG0609     Description: ABC-type cobalamin/Fe3+-siderophores transport systems, permease components Gene: FepC     GI: 20806886     BI number: TTE0374     GOG: COG1120     Description: ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components Gene: CobB     GI: 20806887     BI number: TTE0375     GOG: COG1797     Description: Cobyrinic acid a,c-diamide synthase Gene: CobQ     GI: 20806888     BI number: TTE0376     GOG: COG1492     Description: Cobyric acid synthase Gene: CbiB     GI: 20806889     BI number: TTE0377     GOG: COG1270     Description: Cobalamin biosynthesis protein CobD/CbiB Gene: TTE0378     GI: 20806890     BI number: TTE0378     GOG: NOG09407     Description: hypothetical protein Gene: TTE0379     GI: 20806891     BI number: TTE0379     GOG: NOG07996     Description: conserved hypothetical protein Gene: HisC     GI: 20806892     BI number: TTE0380     GOG: COG0079     Description: Histidinol-phosphate aminotransferase/Tyrosine aminotransferase Gene: CobU     GI: 20806893     BI number: TTE0381     GOG: COG2087     Description: Adenosyl cobinamide kinase/adenosyl cobinamide phosphate guanylyltransferase Gene: CobS     GI: 20806894     BI number: TTE0382     GOG: COG0368     Description: Cobalamin-5-phosphate synthas   a g  g g  g cg ta ta cg cg         t |  t      t  t gt       t  a cg       t  a ta       g  g ta       t  t gc       g  g a  |      t  a a  |      g  a a  |       ta a  |       ta        ca t  |       ta       g  a t  |       cg        cg t  |       cg        cg tg        gt       t  | tg        gc        cg gc       c  t       cg gc       a  |       at |  t      a  |       ta at       g  |       cg at       t  |       tg tg        ta        gc at        gc        gc cg        gc        at                         tttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here [H] COG1797 Cobyrinic acid a,c-diamide synthase ... can be seen here [H] COG1492 Cobyric acid synthase ... can be seen here [H] COG1270 Cobalamin biosynthesis protein CobD/CbiB ... can be seen here [E] COG0079 Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase ... can be seen here [H] COG2087 Adenosyl cobinamide kinase/adenosyl cobinamide phosphate guanylyltransferase ... can be seen here [H] COG0368 Cobalamin-5-phosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................