                                                                        Gene putatively regulated by attenuation in T_tengcongensis

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:187 nt.    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-18.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-gaaaat. It has a score value of 78.31 and is shown in blue

ttgacaaacaaatagaaaggtgagaaaataaaaataaccaattgaatatttgattgaaagtaaaatcttcggggcagggtggaattcccgaccggcagtg
aaagcctgcgagccgcatatgcggttgactcggtgaaattccgaggccgacggtaaaagtccggatgggagaagatttacttttttgtgcctatttgtgt
aaattatttgtaaaaaacccctgaagatttgtcttcaggggttttttaatagaaaaagcaaaagttggaggtgtatttATG

    TTE0534 Gene: TTE0534     GI: 20807035     BI number: TTE0534     GOG: COG3601     Description: conserved hypothetical protei           tt          t  g           at           gc           at           at           gc           ta           cg           cg           cg           cg           at             tttttaatagaaaaagcaaaagttggaggtgtatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3601 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................