Gene putatively regulated by attenuation in T_tengcongensis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=79 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTTAGAGCGCATATTGAATTTAATTAAAAGAGCGGGACTGCCAGCTGACTATGAGGG
TATTGAAAAGACGGATATGCTAAATGCCATAAAGCTTGATAAAAAAATGAGAGAAGGG
AGAATAAATTTTGTTCTACCTGTAGGTTTAGGCAAAGTGGATATTGTGAGTGTGAAAG
AAGAAGATGTATTAAAAGTTTTGAAATAAggcgggtacaccgctttttttattatccttttataaggtttatgaaaaat
ttacttgactttaattaggcaaagtattaaaatatcagcaatatagtATG

    PheA --- AroA --- TyrA --- AroA2 --- OmpR3 --- BaeS5


Gene: PheA     GI: 20807492     BI number: TTE1012     GOG: COG0077     Description: Prephenate dehydratase
Gene: AroA     GI: 20807493     BI number: TTE1013     GOG: COG2876     Description: 3-Deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase
Gene: TyrA     GI: 20807494     BI number: TTE1014     GOG: COG0287     Description: Prephenate dehydrogenase
Gene: AroA2     GI: 20807495     BI number: TTE1015     GOG: COG0128     Description: 5-enolpyruvylshikimate-3-phosphate synthase
Gene: OmpR3     GI: 20807496     BI number: TTE1016     GOG: COG0745     Description: Response regulators consisting of a CheY-like receiver domain and a HTH DNA-binding domain
Gene: BaeS5     GI: 20807497     BI number: TTE1017     GOG: COG0642     Description: Sensory transduction histidine kinase


           AA
          G  A
          T  G
          G  A
          T  A
          G  G
          A  A
          G  A
          T  G
          G  A
          T  T
           TG
           AT
           TA
           AT
           GT
          G  A
          T  A
          G  A
          A  A
 GT       A  G
T  A      A  T
 CG       C  T
 CG       G  T
 AT       G  T
|  T      A  G
T  T       TA
C  A       TA
 TG        TA
 TG        GT
 GC       |  A        a
 TA       G  A      t  c
 TA       A  g      g  a
 TA        Tg        gc
 TG        Gc        gc
 AT        Tg        cg
A  G       Cg        gc
A  G       Cg        gt
 TA        At        At
 AT        Ta        At
                        ttttattatccttttataaggtttatgaaaaatttacttgactttaattaggcaaagtattaaaatatcagcaatatagtATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0077 Prephenate dehydratase ... can be seen here
[E] COG2876 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase ... can be seen here
[E] COG0287 Prephenate dehydrogenase ... can be seen here
[E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here
[TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here
[T] COG0642 Signal transduction histidine kinase ... can be seen here

    ..................................................................................................................