                                                                        Gene putatively regulated by attenuation in T_tengcongensis

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gctccggcggggtcccgaccaattcgcccttcgggctcaggtggtcgctcgcttcgctcgccccgccttcgcccctcaagttcgccaagtttagttaccg
ctttgacaacaagtcgcatttacacacaaaatgccacttttaaactttgtcaacagtctgaaagcacgggaaagtgctttttcttttttataaaaagttg
acagccctttttttatgcgtttataataaaaaacagggattatctacgcttataaaacgtttaccaccactattaaaaataatgtaggaggggttaagaa
ATG

    TTE1864 --- CcmA9 --- NosY Gene: TTE1864     GI: 20808276     BI number: TTE1864     GOG: COG1470     Description: S-layer domain Gene: CcmA9     GI: 20808275     BI number: TTE1863     GOG: COG1131     Description: ABC-type multidrug transport system, ATPase component Gene: NosY     GI: 20808274     BI number: TTE1862     GOG: COG1277     Description: ABC-type transport system involved in multi-copper enzyme maturation, permease componen            tc           g  a           t  a           t  c            ta        ga   c        cg       g  a a  a       at       g  a c  c      a  c       cg a  a       at        at ta        tg        cg ta        ta        gc ta        ta        at at        ta        at cg        cg        at gc       |  c       gt c  c      |  a      t  t ta       |  c      c  | gc       a  g      t  | at        cg        gc at        cg        at                         tttttataaaaagttgacagccctttttttatgcgtttataataaaaaacagggattatctacgcttataaaacgtttaccaccactattaaaaataatgtaggaggggttaagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1470 Predicted membrane protein ... can be seen here [V] COG1131 ABC-type multidrug transport system, ATPase component ... can be seen here [R] COG1277 ABC-type transport system involved in multi-copper enzyme maturation, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in T_tengcongensis This operon is putativelly rgulated by Riboflavin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:118 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -6.10 kcal/mol Antiterminator: Size=37 nt.     Delta G= -4.40 kcal/mol Anti-antiterminator:   Size=27 nt.     Delta G= -5.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case gctccggcggggtcccgaccaattcgcccttcgggctcaggtggtcgctcgcttcgctcgccccgccttcgcccctcaagttcgccaagtttagttaccg ctttgacaacaagtcgcatttacacacaaaatgccacttttaaactttgtcaacagtctgaaagcacgggaaagtgctttttcttttttataaaaagttg acagccctttttttatgcgtttataataaaaaacagggattatctacgcttataaaacgtttaccaccactattaaaaataatgtaggaggggttaagaa ATG     TTE1864 --- CcmA9 --- NosY Gene: TTE1864     GI: 20808276     BI number: TTE1864     GOG: COG1470     Description: S-layer domain Gene: CcmA9     GI: 20808275     BI number: TTE1863     GOG: COG1131     Description: ABC-type multidrug transport system, ATPase component Gene: NosY     GI: 20808274     BI number: TTE1862     GOG: COG1277     Description: ABC-type transport system involved in multi-copper enzyme maturation, permease componen            tt           c  t           a  t           c  a            ca            ga   c        tc a  a      a  t c  c       at a  a       at ta        ag ta        ct ta        ac        ga at        ca       g  a cg       |  a      g  a gc       |  c       cg c  c      |  a       at ta       a  g       cg gc        ct        gc at        ac        at                         ttttcttttttataaaaagttgacagccctttttttatgcgtttataataaaaaacagggattatctacgcttataaaacgtttaccaccactattaaaaataatgtaggaggggttaagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1470 Predicted membrane protein ... can be seen here [V] COG1131 ABC-type multidrug transport system, ATPase component ... can be seen here [R] COG1277 ABC-type transport system involved in multi-copper enzyme maturation, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................