                                                                        Gene putatively regulated by attenuation in T_tengcongensis

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:187 nt.    Distance to gene:11 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-18.60 kcal/mol
Antiterminator:    Distance from promoter:168 nt. Size=24 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:    Distance from promoter:137 nt.    Size=41 nt.     Delta G=-13.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtaa-taatat. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtaaagtatttaacaaacaatttaatattgaaatgggatgaagaatgcgggagagaccctaaccgggcgccgaaggagcaagcgggtatatggcctgt
atactcgtgaaactctcaggcaaaaggaccgcattcggaccatatcccggaaagcctctaaagaggcaccgaaggagcaattcttctataaagaagaatc
tctcaggtaaacagacgggggaataaaaggcgtaaggtccttttattcccctattttggtgatattATG

    TTE1882 --- TrxB --- TrxA4 --- TTE1879 Gene: TTE1882     GI: 20808291     BI number: TTE1882     GOG: NOG40162     Description: GrdX protein Gene: TrxB     GI: 20808290     BI number: TTE1881     GOG: COG0492     Description: Thioredoxin reductase Gene: TrxA4     GI: 20808289     BI number: TTE1880     GOG: COG0526     Description: Thiol-disulfide isomerase and thioredoxins Gene: TTE1879     GI: 20808288     BI number: TTE1879     GOG: NOG43946     Description: grdE proprotei ta a  a ta cg ta ta                  aa cg                 t  g ta                 g  g ta                 c  t at                  gc a  c       aa        gc c  t      a  c       at gc       t  a       at at       g  g       at gc       g  a       at g  a      a  c       ta a  |       cg        at a  |       tg        at g  |       cg        gc cg        tg        gc cg        cg        gc at        ta        gc                         tattttggtgatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0492 Thioredoxin reductase ... can be seen here [OC] COG0526 Thiol-disulfide isomerase and thioredoxins ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................