                                                                        Gene putatively regulated by attenuation in T_tengcongensis

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcgcgggtcatcaagagtaacatgccagaggtgttaagggccgatgaaggtgtgtgaaaggggtgcccgccgaagcgcgtaaacttccttaaggtttacg
cagctgggcctatgccgaacaggtataggactgtcactgaaggctccccaggccttcagtggagagctatctcgctacgggggaaggaggtattgcctat
gtctatgatgaaaatagacagctaaggtaatacttggctgtattttattttgtcttgcaattttataatttaaattattaaagtaaatgaggttgagagt
ATG

    LysA2 Gene: LysA2     GI: 20808385     BI number: TTE1981     GOG: COG0019     Description: Diaminopimelate decarboxylas   g t  a a  a g  a ta at ta cg ta gc ta |  g |  c       aa |  t      t  t a  a      g  a ta        gc cg        at cg        at gt        tg ta        cg ta        gc             tgtattttattttgtcttgcaattttataatttaaattattaaagtaaatgaggttgagagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0019 Diaminopimelate decarboxylase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in T_tengcongensis This operon is putativelly rgulated by Lysine_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-12.90 kcal/mol Antiterminator: Size=38 nt.     Delta G=-12.40 kcal/mol Anti-antiterminator:   Size=36 nt.     Delta G= -6.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case gcgcgggtcatcaagagtaacatgccagaggtgttaagggccgatgaaggtgtgtgaaaggggtgcccgccgaagcgcgtaaacttccttaaggtttacg cagctgggcctatgccgaacaggtataggactgtcactgaaggctccccaggccttcagtggagagctatctcgctacgggggaaggaggtattgcctat gtctatgatgaaaatagacagctaaggtaatacttggctgtattttattttgtcttgcaattttataatttaaattattaaagtaaatgaggttgagagt ATG     LysA2 Gene: LysA2     GI: 20808385     BI number: TTE1981     GOG: COG0019     Description: Diaminopimelate decarboxylas             t        aa gg       c  a      t  t g  g      c  t      g  a c  g      g  g       gc a  a       tt        at ta        tc        at cg        at        tg g  |       ta        cg cg        gt        gc ta        gg        at cg        aa        cg tg       |  t       at at       |  g      g  a ta       |  a      a  | |  t      g  a      t  | |  t       ga       a  | cg        aa        at gc        at        at a  |       ga        at gc        gg        gt at        ga        ta                         ttttgtcttgcaattttataatttaaattattaaagtaaatgaggttgagagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0019 Diaminopimelate decarboxylase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in T_tengcongensis This operon is putativelly rgulated by Lysine_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:55 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -8.10 kcal/mol Antiterminator: Size=38 nt.     Delta G=-12.40 kcal/mol Anti-antiterminator:   Size=36 nt.     Delta G= -6.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case gcgcgggtcatcaagagtaacatgccagaggtgttaagggccgatgaaggtgtgtgaaaggggtgcccgccgaagcgcgtaaacttccttaaggtttacg cagctgggcctatgccgaacaggtataggactgtcactgaaggctccccaggccttcagtggagagctatctcgctacgggggaaggaggtattgcctat gtctatgatgaaaatagacagctaaggtaatacttggctgtattttattttgtcttgcaattttataatttaaattattaaagtaaatgaggttgagagt ATG     LysA2 Gene: LysA2     GI: 20808385     BI number: TTE1981     GOG: COG0019     Description: Diaminopimelate decarboxylas             t tc       c  a t  a      c  t c  g      g  g c  t       tt gg        tc gg        at a  |       ta ca        gt cg        gg ca        aa cg       |  t       aa tc       |  g      t  t ct       |  a      g  a |  a      g  a       gc |  t       ga        at gc        aa        at gt        at        tg a  |       ga        cg ac        gg        gc gg        ga        at                         gtattttattttgtcttgcaattttataatttaaattattaaagtaaatgaggttgagagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0019 Diaminopimelate decarboxylase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................