                                                                        Gene putatively regulated by attenuation in T_elongatus

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:135 nt.    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-13.10 kcal/mol
Antiterminator:    Distance from promoter:103 nt. Size=46 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:    Distance from promoter:69 nt.    Size=48 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatt-taagct. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatttctattactgtcgaactttaagctttgaccccccgaggccaaattatctgagcttaacgagctgctgctaggcagtagtcctgctggtgtaaag
gtagcaactagctttttgccattggccaccgattttagttagctatctccatttgtttctaaacggtgctgtttctgaatccggaaccagcgctcttttc
cattggactgacataatttaggctaggaaaacgATG

    tlr1090 Gene: tlr1090     GI: 22298634     BI number: tlr1090     GOG: COG0620     Description: 5-methyltetrahydropteroyltriglutamate--homocyste ine S-methyltransferas   t        tt a  t      t  c cg        gt cg        ta gc        ta |  c       ta |  a      a  c t  c       cg t  c       cg tg       t  t ta       c  | t  t      t  | c  t      a  |       at gt       t  |      a  c at        cg        gc ta        gc        tg cg        at        cg at        tg        ta at       |  t       ta |  a      |  t      t  c cg       t  t       gc gc        gc        ta at        at        cg ta        tg        gc gt        ta        tg gc        ta        gc                         tcttttccattggactgacataatttaggctaggaaaacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0620 Methionine synthase II (cobalamin-independent) ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................