                                                                        Gene putatively regulated by attenuation in T_thermophilus_HB27

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-24.70 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G=-32.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gccgaaaagccaggtcccgtagccctggtgcctgggcgcgtagtccaggcttaaagtggggaagtccggtgcaagtccggcgctgtcccgcaacggtaac
cggtcacgcgtcaggcccttcgtcgcaggccggaagcccgaatacctgccagggccgtccgcccttccccggggcgggcacctcacgcggatgggggaga
agtgggggataaatggcctttgcctttagcccctgcctcccggcaggggtttttccctacctcccccgggcctggccctagcggccttagggaggtaggc
ATG

    TTC0390 --- fecD --- fecE --- TTC0393 --- TTC0394 Gene: TTC0390     GI: 46198698     BI number: TTC0390     GOG: COG0614     Description: iron(III) dicitrate-binding protein Gene: fecD     GI: 46198699     BI number: TTC0391     GOG: -------     Description: iron(III) dicitrate transport system permease protein fecD Gene: fecE     GI: 46198700     BI number: TTC0392     GOG: COG1120     Description: iron(III) dicitrate transport ATP-binding protein fecE Gene: TTC0393     GI: 46198701     BI number: TTC0393     GOG: -------     Description: hypothetical protein Gene: TTC0394     GI: 46198702     BI number: TTC0394     GOG: -------     Description: 3-oxoacyl-[acyl-carrier protein] reductas   c a  c c  t g  c g  a gc cg gc |  g g  g g  a gt cg cg cg cg        tt tg       c  t ta        cg cg        gc |  a       gc |  a      t  | |  g       at |  t       at cg        at cg        ta g  g      a  g cg        gc cg        gc ta        gc gt        gc |  a       gt        cc |  a       tg       t  c |  a       gc        cg |  t      a  |       cg cg       a  |       gc cg        gc        ta gc        at        cg gc        gc        cg gt        gc        cg at        gc        cg                         tttttccctacctcccccgggcctggccctagcggccttagggaggtaggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................