                                                                        Gene putatively regulated by attenuation in V_cholerae_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:125 nt.    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.70 kcal/mol
Antiterminator:    Distance from promoter:91 nt. Size=39 nt.     Delta G= -7.03 kcal/mol
Anti-antiterminator:    Distance from promoter:53 nt.    Size=53 nt.     Delta G= -8.67 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacg-tattgt. It has a score value of 76.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacgctctctaggggcttgcttattgtgtggtgacttacttggataaatatgcattgatgacacctcatttcctgtacttttttgacttcttttttct
ccaataatgtttggaggctcgctcgttgttcaaagacaagtcaaaaacgaacagaaagcctcctcttaagggggctttttttataaggataactttATG

    VC0705 Gene: VC0705     GI: 15640724     BI number: VC0705     GOG: COG0077,COG1605     Description: chorismate mutase/prephenate dehydratas at a  g t  t at at cg cg ta cg         g tg       a  t |  c      a  c |  t      c  a t  c      a  a t  g      g  a t  c      a  a t  t      a  a t  c      a  c       tt c  g       cg       c  a t  t       ta        ta t  t       ta        cg cg        gc        cg at        ta        tg |  t       tg        cg gc       g  a       cg ta       c  a       gc ta        ta        at ta        cg        at tg        gc        at                         ttttataaggataactttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here     ..................................................................................................................