                                                                        Gene putatively regulated by attenuation in V_cholerae_I

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:138 nt.    Distance to gene:45 nt.     Distance to run of Ts=3 nt.   Size=25 nt.     Delta G=-11.70 kcal/mol
Antiterminator:    Distance from promoter:138 nt. Size=14 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:    Distance from promoter:104 nt.    Size=43 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttcagg-tatatt. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcaggtgcattattcttagccatatattggcaacgaataagcgaggactgtagttggaggaacctctggagagaaccgtttaatcggtcgccgaaggag
caagctctgcgcatatgcagagtgaaactctcaggcaaaaggacagaggagtgaaaggccaatcttttagtgagctcgctagagctctgctgtgcatttt
tcgcaccctttctctcttctccttatgtttattttttaaggggaaatcATG

    VC1422 Gene: VC1422     GI: 15641433     BI number: VC1422     GOG: COG1115     Description: sodium/alanine symporte ag a  g a  c gc ta g  a at gc gt at gt at                  ct |  a                g  a cg                  cg at                  ta g  g                 cg g  a                 gc a  |       gc        at a  |      a  t       gc a  |       gc       |  t a  |       tg        tg cg        gc        gc gc        at        at gt        ta        tg                         tgcatttttcgcaccctttctctcttctccttatgtttattttttaaggggaaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1115 Na+/alanine symporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................