                                                                        Gene putatively regulated by attenuation in V_vulnificus_CMCP6_I

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -4.85 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -9.54 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtaaatctttcaggtgcaatattcttattggttatatcaagagaatatgcgaggactgtagttggaggaacctctggagagaaccgttaaatcggtcgcc
gaaggagcaagtcctgcccatgtgcagggtgaaactctcaggcaaaaggacagaggagtggaaagttataccccaacatgcaccttttcttttgtggctt
gagctttcggccgcaatgttttgctttgttggcccattttagatcctcgatctttacctttccctcttctccttattagttgttttattaaggggaaatc
ATG

    VV12695 Gene: VV12695     GI: 27365986     BI number: VV12695     GOG: COG1115     Description: Na+/alanine symporte            ca ac       g  c g  a      t  c g  g      a  t a  a      c  t a  g      a  t a  g      a  t a  a      c  c cg       c  t gt       c  t g  g      c  t a  |       at cg        tg        ct ta        at       g  t c  a       tg       a  t ta        tg        gc cg        gc        tg at        at       t  | at        at        cg a  a      a  g       gc gt       g  a       gc ta       g  |       tg gc        tg        gc gc        gc        ta gc        at        ta                         tgttttgctttgttggcccattttagatcctcgatctttacctttccctcttctccttattagttgttttattaaggggaaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1115 Na+/alanine symporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in V_vulnificus_CMCP6_I This operon is putativelly rgulated by Glycine_cleavage                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.50 kcal/mol Antiterminator: Size=49 nt.     Delta G= -4.85 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case gtaaatctttcaggtgcaatattcttattggttatatcaagagaatatgcgaggactgtagttggaggaacctctggagagaaccgttaaatcggtcgcc gaaggagcaagtcctgcccatgtgcagggtgaaactctcaggcaaaaggacagaggagtggaaagttataccccaacatgcaccttttcttttgtggctt gagctttcggccgcaatgttttgctttgttggcccattttagatcctcgatctttacctttccctcttctccttattagttgttttattaaggggaaatc ATG     VV12695 Gene: VV12695     GI: 27365986     BI number: VV12695     GOG: COG1115     Description: Na+/alanine symporte gc t  a a  c c  c a  t a  t c  t c  t c  c c  t a  t tt at        ct tg       g  t tt       a  t gg        gc ag        tg ac       t  | at        cg g  t       gc g  g       gc t  |       tg ga        gc ag        ta gc        ta             tgttttgctttgttggcccattttagatcctcgatctttacctttccctcttctccttattagttgttttattaaggggaaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1115 Na+/alanine symporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................