                                                                        Gene putatively regulated by attenuation in V_vulnificus_YJ016_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:122 nt.    Distance to gene:15 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-16.20 kcal/mol
Antiterminator:    Distance from promoter:78 nt. Size=54 nt.     Delta G=-17.00 kcal/mol
Anti-antiterminator:    Distance from promoter:59 nt.    Size=46 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacg-tattgt. It has a score value of 76.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacgctcaatgctggcttgcttattgtgttcccacattcacaaaagtttactatttatgcaaatccactctctgtttagttttgacttcttttttctt
cgatagcggaggggctaactcgtttgtgaaagaaaagtcaaaaacaaacagaaagcctcccacatcggggggcttttttattaaggaaatgagcgATG

    VV0709 --- VV0708 Gene: VV0709     GI: 37678893     BI number: VV0709     GOG: COG0077,COG1605     Description: prephenate dehydratase Gene: VV0708     GI: 37678892     BI number: VV0708     GOG: COG1986     Description: conserved hypothetical protei            aa           a  g            at            gc ag       a  a g  g      a  a g  g      a  a cg       g  a gc        ta at        gc ta        ta |  a       ta |  c       ta at        gc gc       c  | cg        ta         a t  t       cg       c  t t  t      a  a      a  c c  t      a  a       cg t  g       ta        cg t  t       cg        cg tg        gc        tg ta        gc        cg ta        gt        cg ta        gc        gc cg       a  |       at ta        gc        at ta        gc        at                         tttattaaggaaatgagcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here [S] COG1986 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in V_vulnificus_YJ016_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:198 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-15.30 kcal/mol Antiterminator: Size=65 nt.     Delta G= -5.53 kcal/mol Anti-antiterminator:   Size=29 nt.     Delta G= -4.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CAACATAAGCCTGATGCACGTCGAGCTGAAAAACCAGAAGTCGTAGAAGAAGAGTAAt caacaaccagattgagggaatggcgccaaaaggcgccatttttttgcttgacgctcaatgctggcttgcttattgtgttcccacattcacaaaagtttac tatttatgcaaatccactctctgtttagttttgacttcttttttcttcgatagcggaggggctaactcgtttgtgaaagaaaagtcaaaaacaaacagaa agcctcccacatcggggggcttttttattaaggaaatgagcgATG     VV0709 --- VV0708 Gene: VV0709     GI: 37678893     BI number: VV0709     GOG: COG0077,COG1605     Description: prephenate dehydratase Gene: VV0708     GI: 37678892     BI number: VV0708     GOG: COG1986     Description: conserved hypothetical protei            TA           G  A            At            Gc           A  a           A  a           G  c           A  a           A  a           G  c           A  c           T  a           G  |            Cg            Ta            Gt            At           A  g           G  a           A  g            Cg            Cg AA       A  a A  A      A  a A  C      A  | GC       A  | TA       A  |       aa CG       G  |      a  a G  A      T  |       cg A  A      C  |       cg G  G      G  |       gc C  T      A  |       cg T  |       Gt        gc GC        Cg        gc CG        Tg        ta GT        Gc        at TA        Cg        at                         tttttgcttgacgctcaatgctggcttgcttattgtgttcccacattcacaaaagtttactatttatgcaaatccactctctgtttagttttgacttcttttttcttcgatagcggaggggctaactcgtttgtgaaagaaaagtcaaaaacaaacagaaagcctcccacatcggggggcttttttattaaggaaatgagcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here [S] COG1986 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................