Gene putatively regulated by attenuation in V_vulnificus_YJ016_I

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -4.85 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -9.54 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtaaatctttcaggtgcaatattcttattggttatatcaaaagaatatgcgaggactgtagttggaggaacctctggagagaaccgttaaatcggtcgcc
gaaggagcaagtcctgcccatgtgcagggtgaaactctcaggcaaaaggacagaggagtggaaagttataccccaacctgcaccttttcttttgtggctt
gagctttcggccgcaatgttttgctttgttggcccattttagatcctcgatctttacctttccctcttctccttattagttgttttattaaggggaaatc
ATG

    VV1595


Gene: VV1595     GI: 37679779     BI number: VV1595     GOG: COG1115     Description: sodium/alanine symporte


           ca
 ac       g  c
g  a      t  c
g  g      c  t
a  a      c  t
a  g      a  t
a  g      a  t
a  a      c  c
 cg       c  t
 gt       c  t
g  g      c  t
a  |       at
 cg        tg        ct
 ta        at       g  t
c  a       tg       a  t
 ta        tg        gc
 cg        gc        tg
 at        at       t  |
 at        at        cg
a  a      a  g       gc
 gt       g  a       gc
 ta       g  |       tg
 gc        tg        gc
 gc        gc        ta
 gc        at        ta
                        tgttttgctttgttggcccattttagatcctcgatctttacctttccctcttctccttattagttgttttattaaggggaaatcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG1115 Na+/alanine symporter ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Glycine_cleavage sequence ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in V_vulnificus_YJ016_I

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -4.85 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtaaatctttcaggtgcaatattcttattggttatatcaaaagaatatgcgaggactgtagttggaggaacctctggagagaaccgttaaatcggtcgcc
gaaggagcaagtcctgcccatgtgcagggtgaaactctcaggcaaaaggacagaggagtggaaagttataccccaacctgcaccttttcttttgtggctt
gagctttcggccgcaatgttttgctttgttggcccattttagatcctcgatctttacctttccctcttctccttattagttgttttattaaggggaaatc
ATG

    VV1595


Gene: VV1595     GI: 37679779     BI number: VV1595     GOG: COG1115     Description: sodium/alanine symporte


 gc
t  a
c  c
c  c
a  t
a  t
c  t
c  t
c  c
c  t
a  t
 tt
 at        ct
 tg       g  t
 tt       a  t
 gg        gc
 ag        tg
 ac       t  |
 at        cg
g  t       gc
g  g       gc
t  |       tg
 ga        gc
 ag        ta
 gc        ta
            tgttttgctttgttggcccattttagatcctcgatctttacctttccctcttctccttattagttgttttattaaggggaaatcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG1115 Na+/alanine symporter ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Glycine_cleavage sequence ... can be seen here

    ..................................................................................................................