                                                                        Gene putatively regulated by attenuation in X_campestris

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-22.80 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-16.02 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtatgcatgcgcaagcgtgtgagcccgcgagcgcttcgctgccgatctctcgctgagagcacggcggtgaaggtcagcagatccggtgcgatgccggggc
cgacggtatagtccggatgaaagaagacggccaacgcgcagcccttgcggctgcgcgcgcgcctgtttgccttgcggcgtttttcgctcaacttttttgc
gagaaacggctatgtccaccatgcgtcatccagcgtgctaccgcacgccagtccagcgctctacgcgcgccttgcggccattgcccacaggagcgtgctg
ATG

    ribE --- ribA Gene: ribE     GI: 21230170     BI number: XCC0695     GOG: COG0307     Description: riboflavin synthase alpha chain Gene: ribA     GI: 21230171     BI number: XCC0696     GOG: COG0108,COG0807     Description: GTP cyclohydrolase II/3,4-dihydroxy-2-butanone 4-phosphate synthas ta a  g t  t gc gc cg |  g |  a |  t |  g |  a |  a |  a        t |  g      t  g |  a      c  c |  a       cg |  g       cg a  a       gc gc        at        gt cg        cg       t  t cg        gc       c  t gc        cg        cg gc        gc        gc g  a       cg       |  c g  a      a  c      |  t c  c      a  g      |  t cg       c  c       cg gc        cg        gc tg        gc        cg a  c       gc       g  | g  a      |  t       cg cg        cg        gc gc        at        cg                         tttttcgctcaacttttttgcgagaaacggctatgtccaccatgcgtcatccagcgtgctaccgcacgccagtccagcgctctacgcgcgccttgcggccattgcccacaggagcgtgctgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................