                                                                        Gene putatively regulated by attenuation in X_campestris

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-13.90 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATGGCTCCGGTGGCTTCTATCGCAACCAGGTGATGCCGACGGTGCGTTCGCGCATGA
ATATCCCGTTTTTCCTGGGCGATGAGCAGCTCGATGCGTTGTTCGTCAGCGAATCCAA
GGCGGCCGGCTTGCTCGCGCTGAAGGGGCACAAGGCCGTGGGCGGGATCCGCGCTTCG
CTGTACAACGCCATGCCGGTGGCCGGTGCGCAGGCACTGGTGGCCTTCATGCACGATT
TCCAGCAGCGCCACGGCTGAgtcccccacaaccgcggcattgccgcgctggcgcagtgcgccgttttaTTG

    pheA_lrep_1 Gene: pheA_lrep_1     GI: 21231044     BI number: XCC0556     GOG: COG0077,COG1605     Description: P-protei             t           a  t            cg            gc            gc            cg   c        gc c  c       cg t  c      c  c g  c      a  t A  a      a  | Gc       c  | Ta       a  | C  a      c  | Gc       c  | Gc       c  | Cg       c  | A  c       cg         g Cg        tg       a  t Cg        gc        cg Gc       A  g       gc C  a       Gc        cg Gt        Ta        gc At        Cg        gc Cg        Gt        tg                         ttttaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here     ..................................................................................................................