                                                                        Gene putatively regulated by attenuation in X_fastidiosa

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:199 nt.     Distance to run of Ts=3 nt.   Size=20 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-13.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCTGCGGCAGTGCGTTCGCGTATGAATATTCCGTTCTTTTTGCCGAATGTTGAGCA
AGATGCTCGTTTCGCCGCCGAGGCTAAGGCCGCTGGTTTATTATCCTTGAAGGGGCAT
AAAGCGCTTGGCGGCATCCGTGCTTCCCTCTATAACGCCATGCCACTGGCTGGTGTAC
AGGCATTAGTGGCATTTATGCATGATTTTCAACAGCGCTATGGTTGAttttggcgcccataccac
accgtttgagcggcgatgacgatgaggcatttctgctcgtgactaccaagctggtttccaaATG

    XF2325 --- XF2324 --- XF2323 Gene: XF2325     GI: 15838916     BI number: XF2325     GOG: COG0077,COG1605     Description: P-protein Gene: XF2324     GI: 15838915     BI number: XF2324     GOG: COG0128     Description: 3-phosphoshikimate 1-carboxyvinyltransferase Gene: XF2323     GI: 15838914     BI number: XF2323     GOG: -------     Description: hypothetical protei   T T  C A  C TG AT AT GC |  T        G |  T      A  A |  T      A  T T  T       CG AT        GC TG        AT GC        GC C  |       TG GC       T  T CG       G  | TA       T  | TA        AT GT        AT CG        GC GT        CG        GC T  |      C  C      G  T G  |       GC       A  A AT        TG       G  A CG       T  C       CG G  A      T  C       CG G  |       TG        GC CG        TA       C  C GC        CG        CG TA        TG        GC                         TGGTTTATTATCCTTGAAGGGGCATAAAGCGCTTGGCGGCATCCGTGCTTCCCTCTATAACGCCATGCCACTGGCTGGTGTACAGGCATTAGTGGCATTTATGCATGATTTTCAACAGCGCTATGGTTGAttttggcgcccataccacaccgtttgagcggcgatgacgatgaggcatttctgctcgtgactaccaagctggtttccaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here [E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here     ..................................................................................................................