                                                                        Gene putatively regulated by attenuation in X_fastidiosa_Temecula1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:199 nt.     Distance to run of Ts=3 nt.   Size=20 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-13.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCTGCGGCAGTGCGTTCGCGTATGAATATTCCGTTCTTTTTGCCGAATGTTGAGCA
AGATGCTCGTTTCGCCGCCGAGGCTAAGGCCGCTGGTTTATTATCCTTGAAGGGGCAT
AAAGCGGTTGGTGGCATCCGTGCTTCCCTCTATAACGCCATGCCACTGGCTGGTGTGC
AGGCATTAGTGGCATTTATGCATGATTTTCAACAGCGCTATGGTTGAttctggcgcccataccac
accgtttgagcggtgatgacgatgaggcatttttgctcgtgactaccaagctggtttccaaATG

    pheA_lrep_1 --- aroA Gene: pheA_lrep_1     GI: 28199241     BI number: PD0426     GOG: COG0077,COG1605     Description: P-protein Gene: aroA     GI: 28199240     BI number: PD1356     GOG: COG0128     Description: 3-phosphoshikimate 1-carboxyvinyltransferas   T T  C A  C TG AT AT GC |  T        G |  T      A  A |  T      A  T T  T       CG AT        GC TG        AT GC        GC C  |       TG GC       T  T CG       G  | TA       T  | TA        AT GT        AT CG        GC GT        CG        GC T  |      C  C      G  T G  |       GC       A  A AT        TG       G  A CG       T  C       CG G  A      T  C       CG G  |       TG        GC CG        TA       C  C GC        CG        CG TA        TG        GC                         TGGTTTATTATCCTTGAAGGGGCATAAAGCGGTTGGTGGCATCCGTGCTTCCCTCTATAACGCCATGCCACTGGCTGGTGTGCAGGCATTAGTGGCATTTATGCATGATTTTCAACAGCGCTATGGTTGAttctggcgcccataccacaccgtttgagcggtgatgacgatgaggcatttttgctcgtgactaccaagctggtttccaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here [E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here     ..................................................................................................................