                                                                        Gene putatively regulated by attenuation in Y_pestis_KIM

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=13 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G= -4.12 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAGCATGATGATATGTATGCTGCCATTAATGAACTGATCACCAAACTAGAACGCCAA
TTAAATAAAGTTCAACACAAAGGTGAAGCTCGTCGTGCGGCAAGCAGCGTTAAAGACG
CTAATTTGGAGTCTGTAGATGAAGAGGAAACAGAATCCGAACCGGAACAATAGccaactaa
accttctaatttcggtgtaacgcgccttcgggcgcgtttttaattgacatcaattcagactggcggttaatttagctgtgttcattttttagaaaccgtg
agttttaaaataggtaaaccgtaGTG

    pheL Gene: pheL     GI: 22124817     BI number: y0909     GOG: -------     Description: leader peptide of chorismate mutase-P-prephenate dehydratas   a t  a c  a a  c a  c c  t c  t Gc At Ta A  a A  | C  |                 tc At         a       t  g At       a  c       cg Gt       t  g       cg Gc        gc        gc Cg        tg        cg Cg        gc        gc At        gc        cg                         tttttaattgacatcaattcagactggcggttaatttagctgtgttcattttttagaaaccgtgagttttaaaataggtaaaccgtaGTG     ..................................................................................................................