                                                                        Gene putatively regulated by attenuation in Y_pestis_biovar_Mediaevails

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:105 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.10 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-17.50 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-22.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGTTATAGCAGAAGCTAATCCTGAGTAAaacggtggatcaatattgggccgttggtggagatataagtggatcacttt
tcatccgtcgttgacatttataactgacccaaagctgaaagctttactgaacccccagcctagctgggggttttctgggcacaacaagaaagcctcccaa
gcgggaggctttttttatgtatatgcccgtcatacttcaagctgcatgtgcgttagtcgctttcatgcaactcgaattattgaaagtgtaatcattcata
aaaattataaggcaaaagtctATG

    pheA1 Gene: pheA1     GI: 45440256     BI number: YP0400     GOG: COG0077,COG1605     Description: Prephenate dehydratas   t        ac c  a      c  a cg       g  a gc       g  c at       g  a cg        ta cg        cg cg        ta cg        ta cg        ta        ag at        tg       a  c at        gc        cg gt        gc        cg t  t      |  t       cg c  c       gc        ta a  t       gc        cg t  |       gc        cg tg       |  a       gc tg        ta        at cg        cg        at gc        gc        at                         ttttatgtatatgcccgtcatacttcaagctgcatgtgcgttagtcgctttcatgcaactcgaattattgaaagtgtaatcattcataaaaattataaggcaaaagtctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in Y_pestis_biovar_Mediaevails                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:147 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-15.10 kcal/mol                                                                         Nomenclature/Definitions GGGTTATAGCAGAAGCTAATCCTGAGTAAaacggtggatcaatattgggccgttggtggagatataagtggatcacttt tcatccgtcgttgacatttataactgacccaaagctgaaagctttactgaacccccagcctagctgggggttttctgggcacaacaagaaagcctcccaa gcgggaggctttttttatgtatatgcccgtcatacttcaagctgcatgtgcgttagtcgctttcatgcaactcgaattattgaaagtgtaatcattcata aaaattataaggcaaaagtctATG     pheA1 Gene: pheA1     GI: 45440256     BI number: YP0400     GOG: COG0077,COG1605     Description: Prephenate dehydratas            t          c  a           cg           gc           at           cg           cg           cg           cg           cg             ttttctgggcacaacaagaaagcctcccaagcgggaggctttttttatgtatatgcccgtcatacttcaagctgcatgtgcgttagtcgctttcatgcaactcgaattattgaaagtgtaatcattcataaaaattataaggcaaaagtctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here     ..................................................................................................................